Effect of Exosomes Derived from Septic Rats on Immunoregulation of WJ-MSC

doi:10.3969/j.issn.1673-0364.2020.03.013

Abstract

Abstract:

Objective To explore the effect of peripheral blood exosomes from sepsis rats on the immune characteristics of human umbilical cord Wharton's jelly-derived mesenchymal stem cells (WJ-MSC).

Methods The sepsis rat model was established by means of cecal perforation ligation (CLP). Exosomes from peripheral blood of rats in the control group (sham operation group) and experimental group (CLP model group) were extracted to identify their surface markers and morphological characteristics, and pretreated to WJ-MSC. Cell activity of WJ-MSC was detected by CCK8, apoptosis of WJ-MSC was detected by Annexin V-FITC/PI, and qPCR was used to detect the mRNA levels of cytokines (IL-10, TNF-α). The pretreated WJ-MSC was co-cultured with human mononuclear macrophages cells (THP-1) stimulated by LPS, and the mRNA expression of cytokines (IL-6, lL-10, TNF-α, IL-1β) of THP-1 cells was detected by qPCR.

Results There was no significant difference in surface markers and morphological characteristics between the exosomes of experimental and control group. Exosomes of experimental group could not affect the proliferation of WJ-MSC, but inhibited its apoptosis, promoted the mRNA level of IL-10, and reduced the mRNA level of TNF-α. WJ-MSC pretreated by two kinds of exosomes could reduce the expression of pro-inflammatory cytokines (IL-1β,TNF-α) of LPS-stimulated THP-1 cells, but there was no significant difference between the two groups.

Conclusion Exosomes from peripheral blood of sepsis rats can up-regulate the expression of IL-10 in WJ-MSC and down-regulate the expression of TNF-α, which may enhance its immune regulation ability.

Key words: Sepsis, Mesenchymal stem cells derived from human umbilical cord Wharton's jelly, Exosomes, Immunoregulation

CLC Number:

Q813.2

Junyan FANG, Ahui SONG, Yan TONG, Feng DING, Yingli LIU. Effect of Exosomes Derived from Septic Rats on Immunoregulation of WJ-MSC[J]. Journal of Tissue Engineering and Reconstructive Surgery, 2020, 16(3): 223-229.

Figures/Tables 5

Table 1

Fig. 1

Fig. 2

Fig. 3

Fig. 4

References 22

[1]	Ma S, Xie N, Li W , et al. Immunobiology of mesenchymal stem cells[J]. Cell Death Differ, 2014,21(2):216-225.
[2]	Wang LT, Ting CH, Yen ML , et al. Human mesenchymal stem cells (MSCs) for treatment towards immune- and inflammation-mediated diseases: review of current clinical trials[J]. J Biomed Sci, 2016,23(1):76.
[3]	Manochantr S , U-pratya Y, Kheolamai P, et al. Immunosuppressive properties of mesenchymal stromal cells derived from amnion, placenta, Wharton's jelly and umbilical cord[J]. Intern Med J, 2013,43(4):430-439.
[4]	Han C, Sun X, Liu L , et al. Exosomes and their therapeutic potentials of stem cells[J]. Stem Cells Int, 2016,2016:7653489.
[5]	Kourembanas S . Exosomes: vehicles of intercellular signaling, biomarkers, and vectors of cell therapy[J]. Annu Rev Physiol, 2015,77:13-27.
[6]	Simons M, Raposo G . Exosomes-vesicular carriers for intercellular communication[J]. Curr Opin Cell Biol, 2009,21(4):575-581.
[7]	Lötvall J, Hill AF, Hochberg F , et al. Minimal experimental requirements for definition of extracellular vesicles and their functions: a position statement from the International Society for Extracellular Vesicles[J]. J Extracell Vesicles, 2014,3:26913.
[8]	Song Y, Dou H, Li X , et al. Exosomal miR-146a contributes to the enhanced therapeutic efficacy of interleukin-1beta-primed mesenchymal stem cells against sepsis[J]. Stem Cells, 2017,35(5):1208-1221.
[9]	Ti D, Hao H, Tong C , et al. LPS-preconditioned mesenchymal stromal cells modify macrophage polarization for resolution of chronic inflammation via exosome-shuttled let-7b[J]. J Transl Med, 2015,13:308.
[10]	Minasyan H . Sepsis: mechanisms of bacterial injury to the patient[J]. Scand J Trauma Resusc Emerg Med, 2019,27(1):19.
[11]	Salukjuszczak J, Wachowicz B . The proinflammatory activity of lipopolysaccharide[J]. Postepy Biochem, 2005,51(3):280-287.
[12]	Dickson K, Lehmann C . Inflammatory response to different toxins in experimental sepsis models[J]. Int J Mol Sci, 2019,20(18):E4341.
[13]	Raeven P, Zipperle J, Drechsler S . Extracellular vesicles as markers and mediators in sepsis[J]. Theranostics, 2018,8(12):3348-3365.
[14]	Park EJ, Appiah MG, Myint PK , et al. Exosomes in sepsis and inflammatory tissue injury[J]. Curr Pharm Des, 2019,25(42):4486-4495.
[15]	Deng JN, Li YQ, Liu Y , et al. Exosomes derived from plasma of septic patients inhibit apoptosis of T lymphocytes by down-regulating bad via hsa-miR-7-5p[J]. Biochem Biophys Res Commun, 2019,513(4):958-966.
[16]	Li X, Liu LL, Yao JL , et al. Human umbilical cord mesenchymal stem cell-derived extracellular vesicles inhibit endometrial cancer cell proliferation and migration through delivery of exogenous mir-302a[J]. Stem Cells Int, 2019,2019:8108576.
[17]	He C, Zheng S, Luo Y , et al. Exosome theranostics: biology and translational medicine[J]. Theranostics, 2018,8(1):237-255.
[18]	Wu J, Wang Y, Li L . Functional significance of exosomes applied in sepsis: A novel approach to therapy[J]. Biochim Biophys Acta Mol Basis Dis, 2017,1863(1):292-297.
[19]	Zhou Y, Li P, Goodwin AJ , et al. Exosomes from endothelial progenitor cells improve the outcome of a murine model of sepsis[J]. Mol Ther, 2018,26(5):1375-1384.
[20]	Real JM, Ferreira LRP, Esteves GH , et al. Exosomes from patients with septic shock convey miRNAs related to inflammation and cell cycle regulation: new signaling pathways in sepsis[J] ? Crit Care, 2018,22(1):68.
[21]	Exline MC, Steven J, Hollyfield JL , et al. Microvesicular caspase-1 mediates lymphocyte apoptosis in sepsis[J]. PLoS One, 2014,9(3):e90968.
[22]	Wisler JR, Singh K, Mccarty AR , et al. Proteomic Pathway Analysis of Monocyte-Derived Exosomes during Surgical Sepsis Identifies Immunoregulatory Functions[J]. Surg Infect (Larchmt), 2020,21(2):101-111.

基因 gene	引物序列 primer sequence
IL1-β	Forward:5’- ATGATGGCTTATTACAGTGGCAA -3’
	Reverse: 5’-GTCGGAGATTCGTAGCTGGA-3
TNF-α	Forward:5’-CCTCTCTCTAATCAGCCCTCTG-3’
	Reverse: 5’-GAGGACCTGGGAGTAGATGAG-3
IL-10	Forward:5’-ACGGCGCTGTCATCGATTT-3’
	Reverse: 5’-TAGAGTCGCCACCCTGATGT-3
IL-6	Forward:5’- ACTCACCTCTTCAGAACGAATTG-3’
	Reverse: 5’- CCATCTTTGGAAGGTTCAGGTTG-3