Journal of Tissue Engineering and Reconstructive Surgery ›› 2020, Vol. 16 ›› Issue (3): 223-229.doi: 10.3969/j.issn.1673-0364.2020.03.013
Previous Articles Next Articles
Junyan FANG, Ahui SONG, Yan TONG, Feng DING, Yingli LIU
Received:2020-03-22
Revised:2020-05-09
Online:2020-07-27
Published:2020-06-26
CLC Number:
Junyan FANG, Ahui SONG, Yan TONG, Feng DING, Yingli LIU. Effect of Exosomes Derived from Septic Rats on Immunoregulation of WJ-MSC[J]. Journal of Tissue Engineering and Reconstructive Surgery, 2020, 16(3): 223-229.
Table 1
Primer sequence
| 基因 gene | 引物序列 primer sequence |
|---|---|
| IL1-β | Forward:5’- ATGATGGCTTATTACAGTGGCAA -3’ |
| Reverse: 5’-GTCGGAGATTCGTAGCTGGA-3 | |
| TNF-α | Forward:5’-CCTCTCTCTAATCAGCCCTCTG-3’ |
| Reverse: 5’-GAGGACCTGGGAGTAGATGAG-3 | |
| IL-10 | Forward:5’-ACGGCGCTGTCATCGATTT-3’ |
| Reverse: 5’-TAGAGTCGCCACCCTGATGT-3 | |
| IL-6 | Forward:5’- ACTCACCTCTTCAGAACGAATTG-3’ |
| Reverse: 5’- CCATCTTTGGAAGGTTCAGGTTG-3 |
Fig. 2
Effects of exosomes on proliferation and apoptosis of WJ-MSC in each group (**: compared with blank control group, P<0.01) A, B: The proportion of apoptotic cells after exosome treated with WJ-MSC detected by flow cytometry; C: The effects of exosomes on the activity of WJ-MSC detected by CCK8
| [1] | Ma S, Xie N, Li W , et al. Immunobiology of mesenchymal stem cells[J]. Cell Death Differ, 2014,21(2):216-225. |
| [2] | Wang LT, Ting CH, Yen ML , et al. Human mesenchymal stem cells (MSCs) for treatment towards immune- and inflammation-mediated diseases: review of current clinical trials[J]. J Biomed Sci, 2016,23(1):76. |
| [3] | Manochantr S , U-pratya Y, Kheolamai P, et al. Immunosuppressive properties of mesenchymal stromal cells derived from amnion, placenta, Wharton's jelly and umbilical cord[J]. Intern Med J, 2013,43(4):430-439. |
| [4] | Han C, Sun X, Liu L , et al. Exosomes and their therapeutic potentials of stem cells[J]. Stem Cells Int, 2016,2016:7653489. |
| [5] | Kourembanas S . Exosomes: vehicles of intercellular signaling, biomarkers, and vectors of cell therapy[J]. Annu Rev Physiol, 2015,77:13-27. |
| [6] | Simons M, Raposo G . Exosomes-vesicular carriers for intercellular communication[J]. Curr Opin Cell Biol, 2009,21(4):575-581. |
| [7] | Lötvall J, Hill AF, Hochberg F , et al. Minimal experimental requirements for definition of extracellular vesicles and their functions: a position statement from the International Society for Extracellular Vesicles[J]. J Extracell Vesicles, 2014,3:26913. |
| [8] | Song Y, Dou H, Li X , et al. Exosomal miR-146a contributes to the enhanced therapeutic efficacy of interleukin-1beta-primed mesenchymal stem cells against sepsis[J]. Stem Cells, 2017,35(5):1208-1221. |
| [9] | Ti D, Hao H, Tong C , et al. LPS-preconditioned mesenchymal stromal cells modify macrophage polarization for resolution of chronic inflammation via exosome-shuttled let-7b[J]. J Transl Med, 2015,13:308. |
| [10] | Minasyan H . Sepsis: mechanisms of bacterial injury to the patient[J]. Scand J Trauma Resusc Emerg Med, 2019,27(1):19. |
| [11] | Salukjuszczak J, Wachowicz B . The proinflammatory activity of lipopolysaccharide[J]. Postepy Biochem, 2005,51(3):280-287. |
| [12] | Dickson K, Lehmann C . Inflammatory response to different toxins in experimental sepsis models[J]. Int J Mol Sci, 2019,20(18):E4341. |
| [13] | Raeven P, Zipperle J, Drechsler S . Extracellular vesicles as markers and mediators in sepsis[J]. Theranostics, 2018,8(12):3348-3365. |
| [14] | Park EJ, Appiah MG, Myint PK , et al. Exosomes in sepsis and inflammatory tissue injury[J]. Curr Pharm Des, 2019,25(42):4486-4495. |
| [15] | Deng JN, Li YQ, Liu Y , et al. Exosomes derived from plasma of septic patients inhibit apoptosis of T lymphocytes by down-regulating bad via hsa-miR-7-5p[J]. Biochem Biophys Res Commun, 2019,513(4):958-966. |
| [16] | Li X, Liu LL, Yao JL , et al. Human umbilical cord mesenchymal stem cell-derived extracellular vesicles inhibit endometrial cancer cell proliferation and migration through delivery of exogenous mir-302a[J]. Stem Cells Int, 2019,2019:8108576. |
| [17] | He C, Zheng S, Luo Y , et al. Exosome theranostics: biology and translational medicine[J]. Theranostics, 2018,8(1):237-255. |
| [18] | Wu J, Wang Y, Li L . Functional significance of exosomes applied in sepsis: A novel approach to therapy[J]. Biochim Biophys Acta Mol Basis Dis, 2017,1863(1):292-297. |
| [19] | Zhou Y, Li P, Goodwin AJ , et al. Exosomes from endothelial progenitor cells improve the outcome of a murine model of sepsis[J]. Mol Ther, 2018,26(5):1375-1384. |
| [20] | Real JM, Ferreira LRP, Esteves GH , et al. Exosomes from patients with septic shock convey miRNAs related to inflammation and cell cycle regulation: new signaling pathways in sepsis[J] ? Crit Care, 2018,22(1):68. |
| [21] | Exline MC, Steven J, Hollyfield JL , et al. Microvesicular caspase-1 mediates lymphocyte apoptosis in sepsis[J]. PLoS One, 2014,9(3):e90968. |
| [22] | Wisler JR, Singh K, Mccarty AR , et al. Proteomic Pathway Analysis of Monocyte-Derived Exosomes during Surgical Sepsis Identifies Immunoregulatory Functions[J]. Surg Infect (Larchmt), 2020,21(2):101-111. |
| [1] | JI Ouyang, FANG Junyan, SONG Ahui, TONG Yan, WEI Shan, CHEN Zhihao, LIU Yingli. Effect of mesenchymal stem cells-derived exosomes on hyperglycemic injury of human peritoneal mesothelial cells [J]. Journal of Tissue Engineering and Reconstructive Surgery, 2022, 18(4): 294-. |
| [2] | CHEN Hui, HOU Aihua, WANG Peipei, MEI Xiaofeng. . Construction of enhanced green fluorescent protein labeling bladder cancer exosomes and its tracing application in vitro [J]. Journal of Tissue Engineering and Reconstructive Surgery, 2022, 18(4): 300-. |
| [3] | ZHENG Yuzhen, ZHENG Yanjun, ZHOU Yi, QI Xing, CHEN Weiwei, SHI Wen, ZHOU Weijun, YANG Zhitao, CHEN Ying, MAO Enqiang, CHEN Erzhen. The clinical retrospective analysis of 674 hospitalized patients diagnosed with sepsis in a general hospital [J]. Journal of Internal Medicine Concepts & Practice, 2022, 17(04): 278-282. |
| [4] | CHEN Min, CHE Zaiqian, CHEN Ying, MA Li, ZHAO Bing, ZHOU Weijun, MAO Enqiang, CHEN Erzhen. Clinical study of leukocyte-to-platelet ratio in early evaluating prognosis of sepsis [J]. Journal of Internal Medicine Concepts & Practice, 2022, 17(03): 208-213. |
| [5] | WANG Hu, ZHANG Jiaojiao, SUN Junnan, WANG Hairong. Evaluating value of interleukin-6 combined with CD4+ T cell percentage on prognosis in patients with sepsis [J]. Journal of Internal Medicine Concepts & Practice, 2021, 16(06): 404-408. |
| [6] | WANG Xuejie, CHEN Zijin, DU Wen, GU Feifei, YU Haijin, ZHANG Wen, CHEN Xiaonong. Risk factors of acute kidney injury in the patients with bloodstream infection caused by different pathogens [J]. Journal of Internal Medicine Concepts & Practice, 2021, 16(01): 22-26. |
| [7] | WANG Qiuyun, CHEN Ying, ZHAO Bing, SUN Silei, YANG Zhitao, MAO Enqiang, CHEN Erzhen. Sirt1 involved in sepsis-induced acute liver injury via regulating HNF-1α/FXR-1 pathway: The mechanism study in a rodent model [J]. Journal of Diagnostics Concepts & Practice, 2020, 19(03): 279-285. |
| [8] | . [J]. Journal of Internal Medicine Concepts & Practice, 2019, 14(05): 313-316. |
| [9] | . [J]. Journal of Internal Medicine Concepts & Practice, 2018, 13(06): 354-357. |
| [10] | LI Meiling, LI Lei, ZHANG ruyuan, LIU Jialin, QU Hongping. Impact of trace element supplementation on inflammatory response in postoperative patients with sepsis [J]. Journal of Surgery Concepts & Practice, 2018, 23(06): 533-538. |
| [11] | HU Huan,ZHENG Jianghong. The Inhibition of iRGD-Exosomes-Doxorubicin on the Proliferation of Fibroblasts in Vitro [J]. Journal of Tissue Engineering and Reconstructive Surgery, 2017, 13(2): 70-81. |
| [12] | . [J]. Journal of Internal Medicine Concepts & Practice, 2017, 12(05): 351-354. |
| [13] | . [J]. Journal of Surgery Concepts & Practice, 2017, 22(05): 428-432. |
| [14] | . [J]. Journal of Internal Medicine Concepts & Practice, 2017, 12(03): 198-202. |
| [15] | . [J]. Journal of Internal Medicine Concepts & Practice, 2016, 11(05): 301-304. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||