Journal of Internal Medicine Concepts & Practice ›› 2023, Vol. 18 ›› Issue (01): 56-63.doi: 10.16138/j.1673-6087.2023.01.018
• Original article • Previous Articles Next Articles
ZHANG Mengxiao1, SUN Shuoshuo2, WEI Xiao2, ZHANG Shaohong2, CHEN Guofang2(), LIU Chao2()
Received:
2021-08-09
Online:
2023-01-30
Published:
2023-02-13
Contact:
CHEN Guofang,LIU Chao
E-mail:chenguofang9801@163.com;liuchao@nfmcn.com
CLC Number:
ZHANG Mengxiao, SUN Shuoshuo, WEI Xiao, ZHANG Shaohong, CHEN Guofang, LIU Chao. Ketogenic diet promotes hepatic lipid accumulation in db/db mice[J]. Journal of Internal Medicine Concepts & Practice, 2023, 18(01): 56-63.
基因 | 上游引物 | 下游引物 |
---|---|---|
SREBP1C | CACTTCTGGAGACATCGCAAAC | ATGGTAGACAACAGCCGCATC |
SCD1 | TTCTTGCGATACACTCTGGTGC | CGGGATTGAATGTTCTTGTCGT |
PPARα | TATTCGGCTGAAGCTGGTGTAC | CTGGCATTTGTTCCGGTTCT |
ACOX1 | CAAGACCCAAGAGTTCATT | TTCAGGTAGCCATTATCCA |
CD36 | TGGTCAAGCCAGCTAGAAA | CCCAGTCTCATTTAGCCAC |
IL-1β | GAAATGCCACCTTTTGACAGTG | TGGATGCTCTCATCAGGACAG |
TNF-α | CTGAGGTCAATCTGCCCAAGTAC | CTTCACAGAGCAATGACTCCAAAG |
MMP13 | CCTTCTGGTCTTCTGGCACAC | GGCTGGGTCACACTTCTCTGG |
TIMP1 | CGAGACCACCTTATACCAGCG | ATGACTGGGGTGTAGGCGTA |
Col3a1 | ATTGGTGGTTTTCAGTTCAGC | TGGGGTTTCAGAGAGTTTGGC |
Cpl1a1 | ACCTGTGTGTTCCCTACTCA | GACTGTTGCCTTCGCCTCTG |
GAPDH | TGTGGATGGCCCCTCTGGAA | TGACCTTGCCCACAGCCTTG |
[1] |
Bartneck M. Lipid nanoparticle formulations for targeting leukocytes with therapeutic RNA in liver fibrosis[J]. Adv Drug Deliv Rev, 2021, 173:70-88.
doi: 10.1016/j.addr.2021.03.009 URL |
[2] |
Kumar S, Behl T, Sachdeva M, et al. Implicating the effect of ketogenic diet as a preventive measure to obesity and diabetes mellitus[J]. Life Sci, 2021, 264: 118661.
doi: 10.1016/j.lfs.2020.118661 URL |
[3] |
Zhang X, Qin J, Zhao Y, et al. Long-term ketogenic diet contributes to glycemic control but promotes lipid accumulation and hepatic steatosis in type 2 diabetic mice[J]. Nutr Res, 2016, 36(4): 349-358.
doi: S0271-5317(15)00301-2 pmid: 27001280 |
[4] |
Pilone V, Tramontano S, Renzulli M, et al. Metabolic effects, safety, and acceptability of very low-calorie ketogenic dietetic scheme on candidates for bariatric surgery[J]. Surg Obes Relat Dis, 2018, 14(7): 1013-1019.
doi: S1550-7289(18)30144-8 pmid: 29785940 |
[5] |
Schiavo L, Pilone V, Rossetti G, et al. A 4-week preoperative ketogenic micronutrient-enriched diet is effective in reducing body weight, left hepatic lobe volume, and micronutrient deficiencies in patients undergoing bariatric surgery[J]. Obes Surg, 2018, 28(8): 2215-2224.
doi: 10.1007/s11695-018-3145-8 pmid: 29502279 |
[6] |
Rosenbaum M, Hall KD, Guo J, et al. Glucose and lipid homeostasis and inflammation in humans following an isocaloric ketogenic diet[J]. Obesity (Silver Spring), 2019, 27(6): 971-981.
doi: 10.1002/oby.22468 URL |
[7] | Ballieux BE, Dijck LV, Doelder RD, et al. Long-term ketogenic diet (22 weeks) in mice leads to weight gain, hepatic steatosis and impaired glucose tolerance[J]. AJP Endocrinol Metab, 2011, 306(5): E552-E558. |
[8] |
Zhang L, Huang YJ, Sun JP, et al. Protective effects of calorie restriction on insulin resistance and islet function in STZ-induced type 2 diabetes rats[J]. Nutr Metab (Lond), 2021, 18(1): 48.
doi: 10.1186/s12986-021-00575-y URL |
[9] |
Johansson HE, Edholm D, Kullberg J, et al. Energy restriction in obese women suggest linear reduction of hepatic fat content and time-dependent metabolic improvements[J]. Nutr Diabetes, 2019, 9(1): 34.
doi: 10.1038/s41387-019-0100-2 URL |
[10] |
Park CY, Park S, Kim MS, et al. Effects of mild calorie restriction on lipid metabolism and inflammation in liver and adipose tissue[J]. Biochem Biophys Res Commun, 2017, 490(3): 636-642.
doi: 10.1016/j.bbrc.2017.06.090 URL |
[11] |
Garbow JR, Doherty JM, Schugar RC, et al. Hepatic steatosis, inflammation, and ER stress in mice maintained long term on a very low-carbohydrate ketogenic diet[J]. Am J Physiol Gastrointest Liver Physiol, 2011, 300(6): G956-G967.
doi: 10.1152/ajpgi.00539.2010 URL |
[12] |
Bougarne N, Weyers B, Desmet SJ, et al. Molecular actions of PPARα in lipid metabolism and inflammation[J]. Endocr Rev, 2018, 39(5): 760-802.
doi: 10.1210/er.2018-00064 pmid: 30020428 |
[13] |
Naiman S, Huynh FK, Gil R, et al. SIRT6 promotes hepatic beta-oxidation via activation of PPARα[J]. Cell Rep, 2019, 29(12): 4127-4143.
doi: 10.1016/j.celrep.2019.11.067 URL |
[14] |
Cobbina E, Akhlaghi F. Non-alcoholic fatty liver disease (NAFLD)-pathogenesis, classification, and effect on drug metabolizing enzymes and transporters[J]. Drug Metab Rev, 2017, 49(2): 197-211.
doi: 10.1080/03602532.2017.1293683 pmid: 28303724 |
[15] |
Wen B, Zhang C, Zhou J, et al. Targeted treatment of alcoholic liver disease based on inflammatory signalling pathways[J]. Pharmacol Ther, 2021, 222: 107752.
doi: 10.1016/j.pharmthera.2020.107752 URL |
[16] |
Muyyarikkandy MS, McLeod M, Maguire M, et al. Branched chain amino acids and carbohydrate restriction exacerbate ketogenesis and hepatic mitochondrial oxidative dysfunction during NAFLD[J]. FASEB J, 2020, 34(11): 14832-14849.
doi: 10.1096/fj.202001495R URL |
[17] |
Ott B, Skurk T, Hastreiter L, et al. Effect of caloric restriction on gut permeability, inflammation markers, and fecal microbiota in obese women[J]. Sci Rep, 2017, 7(1): 11955.
doi: 10.1038/s41598-017-12109-9 pmid: 28931850 |
[18] |
Jordan S, Tung N, Casanova-Acebes M, et al. Dietary intake regulates the circulating inflammatory monocyte pool[J]. Cell, 2019, 178(5): 1102-1114.
doi: S0092-8674(19)30850-5 pmid: 31442403 |
[19] |
Huang Y, Lu J, Xu Y, et al. Xiaochaihu decorction relieves liver fibrosis caused by Schistosoma japonicum infection via the HSP47/TGF-β pathway[J]. Parasit Vectors, 2020, 13(1): 254.
doi: 10.1186/s13071-020-04121-2 URL |
[20] |
Guo J, Liu W, Zeng Z, et al. Tgfb3 and Mmp13 regulated the initiation of liver fibrosis progression as dynamic network biomarkers[J]. J Cell Mol Med, 2020, 25(2): 867-879.
doi: 10.1111/jcmm.16140 URL |
[21] |
Miryounesi M, Piryaei A, Pournasr B, et al. Repeated versus single transplantation of mesenchymal stem cells in carbon tetrachloride-induced liver injury in mice[J]. Cell Biol Int, 2013, 37(4): 340-347.
pmid: 23408711 |
[22] |
Rusli F, Boekschoten MV, Borelli V, et al. Plasticity of lifelong calorie-restricted C57BL/6J mice in adapting to a medium-fat diet intervention at old age[J]. Aging Cell, 2018, 17(2): e12696.
doi: 10.1111/acel.12696 URL |
[23] |
Zhao L, Zhang C, Luo X, et al. CD36 palmitoylation disrupts free fatty acid metabolism and promotes tissue inflammation in non-alcoholic steatohepatitis[J]. J Hepatol, 2018, 69(3): 705-717.
doi: S0168-8278(18)32014-2 pmid: 29705240 |
[24] |
Liang X, Xie G, Wu X, et al. Effect of prenatal PFOS exposure on liver cell function in neonatal mice[J]. Environ Sci Pollut Res Int, 2019, 26(18): 18240-18246.
doi: 10.1007/s11356-019-05245-4 URL |
[1] |
YANG Yan, SHANG Ying, LYU Qiang, et al.
Treatment of rabbit ear hypertrophic scar by CO2 fractional laser-assisted silk nanofiber hydrogel-loaded asiaticoside [J]. Journal of Tissue Engineering and Reconstructive Surgery, 2022, 18(3): 227-. |
[2] | KANG Jie* (亢洁), DING Jumin (丁菊敏), LEI Tao (雷涛),FENG Shujie (冯树杰), LIU Gang (刘港). Interactive Liver Segmentation Algorithm Based on Geodesic Distance and V-Net [J]. J Shanghai Jiaotong Univ Sci, 2022, 27(2): 190-201. |
[3] | ZHU Siyi, CHEN Xiaosong, SHEN Kunwei. Study on obesity associated with prognosis of early breast cancer and efficacy of adjuvant therapy [J]. Journal of Surgery Concepts & Practice, 2022, 27(05): 468-472. |
[4] | YE Yafen, YANG Ying, HAN Junfeng. Research advances in adipose tissue aging related cytological changes and molecular [J]. Journal of Diagnostics Concepts & Practice, 2022, 21(05): 650-654. |
[5] | XU Doudou, CHEN Ying, LÜ Ankang, WU Beiwen. A retrospective cohort study on the correlation between triglyceride-glucose index and new-onset fatty liver disease [J]. Journal of Internal Medicine Concepts & Practice, 2022, 17(04): 301-306. |
[6] | CHEN Congyan, WANG Junqing, CHEN Yongjun. Gut microbiota and mechanism of liver cancer [J]. Journal of Surgery Concepts & Practice, 2022, 27(03): 256-260. |
[7] | WU Haoxiang, LÜ Zicheng, HOU Yuchen, ZHANG Zijie, QIAO Ziyun, FENG Hao, XIA Qiang. Tacrolimus intra-patient variability in pediatric liver transplantation [J]. Journal of Surgery Concepts & Practice, 2022, 27(02): 145-151. |
[8] | ZHANG Lei, MAO Jiaxi, LI Tao, TENG Fei, SUN Keyan. Effect of preoperative immunoinflammatory response on prognosis in patients undergoing liver transplantation for primary biliary cholangitis: a two-center retrospective study [J]. Journal of Surgery Concepts & Practice, 2022, 27(02): 158-164. |
[9] | NING Ling, LIU Zhenjun, LI Wei, LIU Wen, LI Wei, ZHANG Zhenhua, FANG Weidong, GAO Youfang, ZHENG Xiaowei, LI Lei. Pathological and etiological analysis of cholestatic liver disease in Anhui [J]. Journal of Internal Medicine Concepts & Practice, 2022, 17(01): 53-57. |
[10] | CAI Xiaoting, YI Huahua, LIN Jiayuan, CHEN Ling. Autosomal dominant polycystic kidney disease complicated with pulmonary embolism: a case report and literature review [J]. Journal of Diagnostics Concepts & Practice, 2022, 21(01): 80-85. |
[11] | WANG Bin,ZHANG Xueqing. Challenges and Opportunities in BrainTargeted Delivery [J]. Journal of Shanghai Jiao Tong University, 2021, 55(Sup.1): 62-64. |
[12] | ZHAO Yingmei, NIE Hongming, ZHANG Jue, HUANG Yan. Detection of five coagulation indices in patients with cirrhosis and its clinical significance [J]. Journal of Diagnostics Concepts & Practice, 2021, 20(05): 480-483. |
[13] | FENG Mingyang, DING Yezhou, ZHAO Qingqing, ZHAO Gangde, LOU Shike, ZHENG Chao, SUN Xuehua, LIU Kehui, LIN Lanyi, XIE Qing, ZHENG Lan, WANG HUI. Relation of TCM syndrome type in traditional Chinese medicine with liver failure staging in Western medicine in patients with liver failure [J]. Journal of Diagnostics Concepts & Practice, 2021, 20(04): 391-395. |
[14] | QI Debin, CHEN Peng, TONG Hui, PENG Chenghong, LI Tao. Retrospective analysis of immunosuppression drug withdrawal after liver transplantation [J]. Journal of Surgery Concepts & Practice, 2021, 26(03): 231-235. |
[15] | ZUO Guangmin, PENG Kui, LI Mian, XU Min, BI Yufang, NING Guang. The association between fatty liver index and microalbuminuria in middle-aged and elderly population in Shanghai [J]. Journal of Diagnostics Concepts & Practice, 2020, 19(06): 605-609. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||