Ketogenic diet promotes hepatic lipid accumulation in db/db mice

doi:10.16138/j.1673-6087.2023.01.018

Abstract

Abstract:

Objectives To study the effect of ketogenic diet （KD） on liver lipid deposition in db/db mice, and to investigate the safety of KD treatment and molecular mechanism in db/db mice. Methods Twenty eight-week-old db/db male mice of obesity type 2 diabetes mellitus(T2DM) were selected. After 3 weeks of adaptive feeding, 18 mice were enrolled and randomly divided into 3 groups: normal feeding (ND) group (n=6), KD group (n=6) and 75% caloric restriction (CR) group(n=6). In addition, 6 eight-week-old C57BL/6 male mice were fed with standard control diet and considered as normal (C) group. C and ND groups were free to get the standard feed, KD group was free to get the ketogenic feed, and CR group was the positive control group, which consumed 75% of standard feed calories of ND group each day. After 4 weeks of diet treatment, 2 mice in KD group and 1 mouse in CR group died. Three mice in each group were randomly included for statistical analysis, and the levels of fasting triglyceride(TG), total cholesterol(TC) and low-density lipoprotein cholesterol(LDL-C) in each group were detected and compared. The morphology and structure of liver were observed by hematoxylin and eosin(HE) staining. The size and number of lipid droplets in liver tissue of mice were observed by oil red O staining. The quantitative polymerase chain reaction (qPCR) was used to detect the expression of sterol regulatory element-binding protein 1C (SREBP1C), stearoyl-CoA desaturase 1 (SCD1), acyl-CoA oxidase 1 (ACOX1), peroxisome proliferator-activated receptor α (PPARα), cluster of differentiation 36 (CD36), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), matrix metalloproteinase-13 (MMP13), matrix metalloproteinase-inhibitor 1(TIMP1), collagen type Ⅲ alpha 1 (COL3a1) and collagen type Ⅰ alpha 1 (COL1a1) in liver. Immunohistochemistry (IHC) and western blot (WB) were used to detect the expression of fatty acid translocase (CD36) in liver tissues. Results After 4 weeks of dietary intervention, compared with ND group, the level of TG, TC and LDL-C in KD group was not improved, but the level of TG in CR group was significantly decreased (P<0.05). HE and oil red O staining showed that liver vacuolar degeneration and lipid deposition increased in KD group compared with ND and CR groups. qPCR showed that compared with ND group, lipid-catabolism genes such as PPARα and ACOX1 showed decreased trend in KD group without significant difference; the expression of CD36, IL-1β and TNF-α was significantly increased (P<0.05). The expression of MMP13 was significantly decreased(P<0.05), while the expression of other hepatic fibrosis related genes was not changed. IHC showed that compared with ND group, the expression level of CD36 protein in KD group was significantly increased(P<0.05). Conclusions KD could induce liver lipid deposition, aggravate liver inflammation in db/db mice. Therefore, in the treatment of obesity with KD, the changes of liver function should be closely observed to prevent the occurrence of adverse reactions.

Key words: Type 2 diabetes mellitus, Obesity, Ketogenic diet, Liver, Fat deposition

CLC Number:

R587.1

ZHANG Mengxiao, SUN Shuoshuo, WEI Xiao, ZHANG Shaohong, CHEN Guofang, LIU Chao. Ketogenic diet promotes hepatic lipid accumulation in db/db mice[J]. Journal of Internal Medicine Concepts & Practice, 2023, 18(01): 56-63.

Figures/Tables 7

References 24

[1]	Bartneck M. Lipid nanoparticle formulations for targeting leukocytes with therapeutic RNA in liver fibrosis[J]. Adv Drug Deliv Rev, 2021, 173:70-88. doi: 10.1016/j.addr.2021.03.009 URL
[2]	Kumar S, Behl T, Sachdeva M, et al. Implicating the effect of ketogenic diet as a preventive measure to obesity and diabetes mellitus[J]. Life Sci, 2021, 264: 118661. doi: 10.1016/j.lfs.2020.118661 URL
[3]	Zhang X, Qin J, Zhao Y, et al. Long-term ketogenic diet contributes to glycemic control but promotes lipid accumulation and hepatic steatosis in type 2 diabetic mice[J]. Nutr Res, 2016, 36(4): 349-358. doi: S0271-5317(15)00301-2 pmid: 27001280
[4]	Pilone V, Tramontano S, Renzulli M, et al. Metabolic effects, safety, and acceptability of very low-calorie ketogenic dietetic scheme on candidates for bariatric surgery[J]. Surg Obes Relat Dis, 2018, 14(7): 1013-1019. doi: S1550-7289(18)30144-8 pmid: 29785940
[5]	Schiavo L, Pilone V, Rossetti G, et al. A 4-week preoperative ketogenic micronutrient-enriched diet is effective in reducing body weight, left hepatic lobe volume, and micronutrient deficiencies in patients undergoing bariatric surgery[J]. Obes Surg, 2018, 28(8): 2215-2224. doi: 10.1007/s11695-018-3145-8 pmid: 29502279
[6]	Rosenbaum M, Hall KD, Guo J, et al. Glucose and lipid homeostasis and inflammation in humans following an isocaloric ketogenic diet[J]. Obesity (Silver Spring), 2019, 27(6): 971-981. doi: 10.1002/oby.22468 URL
[7]	Ballieux BE, Dijck LV, Doelder RD, et al. Long-term ketogenic diet (22 weeks) in mice leads to weight gain, hepatic steatosis and impaired glucose tolerance[J]. AJP Endocrinol Metab, 2011, 306(5): E552-E558.
[8]	Zhang L, Huang YJ, Sun JP, et al. Protective effects of calorie restriction on insulin resistance and islet function in STZ-induced type 2 diabetes rats[J]. Nutr Metab (Lond), 2021, 18(1): 48. doi: 10.1186/s12986-021-00575-y URL
[9]	Johansson HE, Edholm D, Kullberg J, et al. Energy restriction in obese women suggest linear reduction of hepatic fat content and time-dependent metabolic improvements[J]. Nutr Diabetes, 2019, 9(1): 34. doi: 10.1038/s41387-019-0100-2 URL
[10]	Park CY, Park S, Kim MS, et al. Effects of mild calorie restriction on lipid metabolism and inflammation in liver and adipose tissue[J]. Biochem Biophys Res Commun, 2017, 490(3): 636-642. doi: 10.1016/j.bbrc.2017.06.090 URL
[11]	Garbow JR, Doherty JM, Schugar RC, et al. Hepatic steatosis, inflammation, and ER stress in mice maintained long term on a very low-carbohydrate ketogenic diet[J]. Am J Physiol Gastrointest Liver Physiol, 2011, 300(6): G956-G967. doi: 10.1152/ajpgi.00539.2010 URL
[12]	Bougarne N, Weyers B, Desmet SJ, et al. Molecular actions of PPARα in lipid metabolism and inflammation[J]. Endocr Rev, 2018, 39(5): 760-802. doi: 10.1210/er.2018-00064 pmid: 30020428
[13]	Naiman S, Huynh FK, Gil R, et al. SIRT6 promotes hepatic beta-oxidation via activation of PPARα[J]. Cell Rep, 2019, 29(12): 4127-4143. doi: 10.1016/j.celrep.2019.11.067 URL
[14]	Cobbina E, Akhlaghi F. Non-alcoholic fatty liver disease (NAFLD)-pathogenesis, classification, and effect on drug metabolizing enzymes and transporters[J]. Drug Metab Rev, 2017, 49(2): 197-211. doi: 10.1080/03602532.2017.1293683 pmid: 28303724
[15]	Wen B, Zhang C, Zhou J, et al. Targeted treatment of alcoholic liver disease based on inflammatory signalling pathways[J]. Pharmacol Ther, 2021, 222: 107752. doi: 10.1016/j.pharmthera.2020.107752 URL
[16]	Muyyarikkandy MS, McLeod M, Maguire M, et al. Branched chain amino acids and carbohydrate restriction exacerbate ketogenesis and hepatic mitochondrial oxidative dysfunction during NAFLD[J]. FASEB J, 2020, 34(11): 14832-14849. doi: 10.1096/fj.202001495R URL
[17]	Ott B, Skurk T, Hastreiter L, et al. Effect of caloric restriction on gut permeability, inflammation markers, and fecal microbiota in obese women[J]. Sci Rep, 2017, 7(1): 11955. doi: 10.1038/s41598-017-12109-9 pmid: 28931850
[18]	Jordan S, Tung N, Casanova-Acebes M, et al. Dietary intake regulates the circulating inflammatory monocyte pool[J]. Cell, 2019, 178(5): 1102-1114. doi: S0092-8674(19)30850-5 pmid: 31442403
[19]	Huang Y, Lu J, Xu Y, et al. Xiaochaihu decorction relieves liver fibrosis caused by Schistosoma japonicum infection via the HSP47/TGF-β pathway[J]. Parasit Vectors, 2020, 13(1): 254. doi: 10.1186/s13071-020-04121-2 URL
[20]	Guo J, Liu W, Zeng Z, et al. Tgfb3 and Mmp13 regulated the initiation of liver fibrosis progression as dynamic network biomarkers[J]. J Cell Mol Med, 2020, 25(2): 867-879. doi: 10.1111/jcmm.16140 URL
[21]	Miryounesi M, Piryaei A, Pournasr B, et al. Repeated versus single transplantation of mesenchymal stem cells in carbon tetrachloride-induced liver injury in mice[J]. Cell Biol Int, 2013, 37(4): 340-347. pmid: 23408711
[22]	Rusli F, Boekschoten MV, Borelli V, et al. Plasticity of lifelong calorie-restricted C57BL/6J mice in adapting to a medium-fat diet intervention at old age[J]. Aging Cell, 2018, 17(2): e12696. doi: 10.1111/acel.12696 URL
[23]	Zhao L, Zhang C, Luo X, et al. CD36 palmitoylation disrupts free fatty acid metabolism and promotes tissue inflammation in non-alcoholic steatohepatitis[J]. J Hepatol, 2018, 69(3): 705-717. doi: S0168-8278(18)32014-2 pmid: 29705240
[24]	Liang X, Xie G, Wu X, et al. Effect of prenatal PFOS exposure on liver cell function in neonatal mice[J]. Environ Sci Pollut Res Int, 2019, 26(18): 18240-18246. doi: 10.1007/s11356-019-05245-4 URL

基因	上游引物	下游引物
SREBP1C	CACTTCTGGAGACATCGCAAAC	ATGGTAGACAACAGCCGCATC
SCD1	TTCTTGCGATACACTCTGGTGC	CGGGATTGAATGTTCTTGTCGT
PPARα	TATTCGGCTGAAGCTGGTGTAC	CTGGCATTTGTTCCGGTTCT
ACOX1	CAAGACCCAAGAGTTCATT	TTCAGGTAGCCATTATCCA
CD36	TGGTCAAGCCAGCTAGAAA	CCCAGTCTCATTTAGCCAC
IL-1β	GAAATGCCACCTTTTGACAGTG	TGGATGCTCTCATCAGGACAG
TNF-α	CTGAGGTCAATCTGCCCAAGTAC	CTTCACAGAGCAATGACTCCAAAG
MMP13	CCTTCTGGTCTTCTGGCACAC	GGCTGGGTCACACTTCTCTGG
TIMP1	CGAGACCACCTTATACCAGCG	ATGACTGGGGTGTAGGCGTA
Col3a1	ATTGGTGGTTTTCAGTTCAGC	TGGGGTTTCAGAGAGTTTGGC
Cpl1a1	ACCTGTGTGTTCCCTACTCA	GACTGTTGCCTTCGCCTCTG
GAPDH	TGTGGATGGCCCCTCTGGAA	TGACCTTGCCCACAGCCTTG

项目	C组	ND组	KD组	CR组	F	P
TG(mmol/L)	1.07±0.40	3.01±0.20¹⁾	2.19±0.08	1.54±0.33²⁾	8.999	0.006 1
TC(mg/dL)	76.34±2.03	150.27±5.12¹⁾	27.87±14.40¹⁾	35.45±0.79¹⁾	17.34	0.000 7
LDL-C(mmol/L)	2.19±0.17	5.78±0.10¹⁾	3.70±1.33	4.60±0.33	4.729	0.035 1

项目	C组	ND组	KD组	CR组	F	P
SREBP1C	1	0.37±0.04¹⁾	0.12±0.02¹⁾²⁾	0.49±0.05¹⁾	116.8	<0.000 1
Scd1	1	0.51±0.01¹⁾	0.004±0.002¹⁾²⁾	0.99±0.12²⁾	59.9	<0.000 1
PPARα	1	0.49±0.05¹⁾	0.33±0.04¹⁾	0.72±0.04¹⁾²⁾	59.48	<0.000 1
Acox1	1	0.58±0.02¹⁾	0.38±0.08¹⁾²⁾	0.78±0.03¹⁾²⁾	40.02	<0.000 1

项目	C组	ND组	KD组	CR组	F	P
IL-1β	1	1.14±0.10	2.76±0.53¹⁾²⁾	0.69±0.076²⁾	11.61	0.002 8
TNF-α	1	1.46±0.11¹⁾	3.22±0.46¹⁾²⁾	0.90±0.04²⁾	20.76	0.000 4

项目	C组	ND组	KD组	CR组	F	P
TIMP1	1	1.46±0.09¹⁾	1.72±0.05¹⁾	1.18±0.07	24.80	0.000 2
Col3a1	1	2.33±0.27¹⁾	2.85±0.25¹⁾	1.46±0.15	17.76	0.000 7
Col1a1	1	3.05±0.36¹⁾	4.47±0.74¹⁾	1.59±0.24	13.26	0.001 8
MMP13	1	0.69±0.05¹⁾	0.40±0.07¹⁾²⁾	0.67±0.08¹⁾	18.32	0.000 6